cDNA Clone - RAB8A

Name: RAB8A
Price per aliquot: £110.00
Expressed:
MBP 6HIS SUMO RAB8A
Plasmid:
pMEX 6HIS SUMO Rab8A
Parent Plasmid:
pMEX 6HIS SUMO
View Parent Plasmid

|
DU Number:
DU26902
Species:
Human
Sequence of Insert:
View Sequence

GGATCCATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACTCGGGGGTGGGGAAGACCTGTGTCCTGTTCCGCTTCTCCGAGGACGCCTTCAACTCCACTTTTATCTCCACCATAGGAATTGACTTTAAAATTAGGACCATAGAGCTCGATGGCAAGAGAATTAAACTGCAGATATGGGACACAGCCGGTCAGGAACGGTTTCGGACGATCACAACGGCCTACTACAGGGGTGCAATGGGCATCATGCTGGTCTACGACATCACCAACGAGAAGTCCTTCGACAACATCCGGAACTGGATTCGCAACATTGAGGAGCACGCCTCTGCAGACGTCGAAAAGATGATACTCGGGAACAAGTGTGATGTGAATGACAAGAGACAAGTTTCCAAGGAACGGGGAGAAAAGCTGGCCCTCGACTATGGAATCAAGTTCATGGAGACCAGCGCGAAGGCCAACATCAATGTGGAAAATGCATTTTTCACTCTCGCCAGAGATATCAAAGCAAAAATGGACAAAAAATTGGAAGGCAACAGCCCCCAGGGGAGCAACCAGGGAGTCAAAATCACACCGGACCAGCAGAAGAGGAGCAGCTTTTTCCGATGTGTTCTTCTGTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELVKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGDDDDKVPEFLEVLFQGPGSMGHHHHHHSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLRFLFEGQRIADNHTPKELGMEEEDVIEVYQEQTGGSMAKTYDYLFKLLLIGDSGVGKTCVLFRFSEDAFNSTFISTIGIDFKIRTIELDGKRIKLQIWDTAGQERFRTITTAYYRGAMGIMLVYDITNEKSFDNIRNWIRNIEEHASADVEKMILGNKCDVNDKRQVSKERGEKLALDYGIKFMETSAKANINVENAFFTLARDIKAKMDKKLEGNSPQGSNQGVKITPDQQKRSSFFRCVLL*
Antibiotic:
Amp
Low Growth Temperature Requirement?:
No
Comments:
Needs linker after SENP cleavage deleted

Do you need any help? Please get in touch and we’ll be happy to lend a hand.