cDNA Clone - RAB43

Name: RAB43
Price per aliquot: £110.00
Expressed:
RAB43 ex1 KO antisense guide + Cas9n
Plasmid:
pX335 RAB43 ex1 KO antisense
Parent Plasmid:
pX335
View Parent Plasmid

|
DU Number:
DU54350
Genbank:
Species:
Human
Synonyms:
RAB11B, RAB41
Sequence of Insert:
View Sequence

GCCTGTTCAAGCTGGTGCTGG
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR KO guide targeting exon 1, use in conjunction with 54344.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.