cDNA Clone - RAB8B

Name: RAB8B
Price per aliquot: £110.00
Expressed:
RAB8A KO sense + RAB8B KO sense + Cas9hf1 + Puro
Plasmid:
pCMV Cas9hf1 2AP RAB8A KO sense + RAB8B KO sense
Parent Plasmid:
pCMV Cas9hf1 Puro U6
View Parent Plasmid

|
DU Number:
DU54323
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GTTCATCTCCACCATCGGTGA
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR single vector system targeting RAB8A exon 1 and RAB8B exon 1. Expresses all necessary components including High Fidelity Cas9 and Puro for selection.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.