cDNA Clone SPT2 HBD (571-685) M641A

• Synonyms: SPTY2D1
• Plasmid: His14-SUMO-SPT2 HBD (571-685) M641A
• Parent Plasmid: pK27SUMO
• Expressed: His14-SUMO-SPT2 HBD (571-685) M641A
• Genbank: NM_194285.2
• Species: Human

Sequence of Insert

see snapgene map

• Vector Type: Bacterial
• Antibiotic: Kan
• Full Snapgene Map: His14-SUMO-SPT2 HBD (571-685) M641A33.21 KB Snapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU70519
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Deposited by Giulia Saredi (John Rouse lab). The plasmid was obtained by performing deletion mutagenesis on template plasmid DU70515, via InFusion cloning using primers GSA38 and GSA39.; GSA38 - GGTCCTCAAAGGCTTCCCTTCCCTACTGGT; GSA39 - AAGCCTTTGAGGACCGCCACCAATCTGTTC; (#97 in GSaredi library)
• Low Temp: No