cDNA Clone SPT2

• Synonyms: SPTY2D1
• Plasmid: pK27 2xFlag-SUMO-SPT2-His6
• Expressed: 2xFlag-SUMO-SPT2-His6
• Genbank: NM_194285.2
• Species: Human

Sequence of Insert

see snapgene file

• Vector Type: Bacterial
• Antibiotic: Kan
• Full Snapgene Map: pK27 2xFlag-SUMO-SPT2-His6 51.67 KB Snapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU70522
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Several passages led to the production of this plasmid, as we were seeking a robust expression strategy for full length SPT2. First, C-terminal TEV-Flag tags were added in a stepwise process to plasmid DU70516. DU70516 was used as a template for amplification with primers GSA51 and GSA52 to obtain plasmid #103 (His14-SUMO-CeSPT-2-TEV-FLAG intermediate 1), by InFusion cloning. Plasmid #103 was used as a template for amplification with primers GSA53 and GSA54 to obtain plasmid #104 (His14-SUMO-CeSPT-2-TEV-FLAG intermediate 2), by InFusion cloning. Plasmid #104 was used as a template for amplification with primers GSA55 and GSA56 to obtain plasmid #105 (His14-SUMO-CeSPT-2-TEV-Flag), by InFusion cloning. The C-terminal Flag tag was then removed and replaced with a His6 tag: plasmid #105 was used as a template for amplification with primers GSA72 and GSA73 to obtain plasmid #107 (His14-SUMO-CeSPT-2-TEV-linker-His6), by InFusion cloning. Then, the His14 tag was removed by amplifying plasmid #107 with primers GSA76 and GSA77 to obtain plasmid #106 (SUMO-CeSPT-2-TEV-linker-His6). Last, a mini 2xFlag tag (Yeeles REF) was added at the N-terminus: plasmid #106 was amplified using primers GSA86 and GSA87 and re-ligated by InFusion cloning, to obtain plasmid #111 (2xFlag-SUMO-CeSPT-2-TEV-linker-His6). The newly obtained 2xFlag-SUMO-TEV-His6 vector was opened and linearized by inverse PCR using primers GSA88 and GSA89. Human SPT2 cDNA was amplified from DU70514 using primers GSA90 and GSA91, which added 15nt overhangs corresponding to the ends of the linearised 2xFlag-SUMO-TEV-His6 vector, and the two fragments ligated by InFusion cloning to obtain DU70522.; ; Primers:; GSA51 AATACAGGTTTTCactaccCAATTTAACAGAACG; GSA52 gtGAAAACCTGTATTTTCAGTAATAAgcggccgca; ; GSA53 cactaccactaccactGCCCTGAAAATACAGGTT; ; GSA54 gtggtagtggtagtggtagtTAATAAgcggccgcac; GSA55 CGTCATCGTCCTTGTAGTCactaccactaccact; GSA56 ACAAGGACGATGACGATAAGTAATAAgcggccgcac; GSA72 catcaccatcaccatcacTAATAAgcggccgc; GSA73 gtgatggtgatggtgatgactaccactaccac; GSA86 ATGACGGCGACTACAAAGACGATGACTCGGACTCAGAAGTC; ; GSA87 GTAGTCGCCGTCATCGTCTTTGTAGTCcatggTTAATTTCtCC; ; GSA88 GCCACCAATCTGTTCTCTGT; ; GSA89 ggtagtGAAAACCTGTATTTTCAGGGC; GSA90 GAACAGATTGGTGGCATGGACTTCAGAGAA; GSA91 CAGGTTTTCactaccACGCCTCTTCAGCTT; ; Number 112 in GSA library.
• Low Temp: No