cDNA Clone TMEM55B

• Synonyms: PIP4P1, C14orf9
• Plasmid: pX335 TMEM55B ex2 KO Antisense A
• Parent Plasmid: pX335
• Expressed: TMEM55B ex2 KO Antisense A + Cas9n
• Genbank: ENSG00000165782
• Species: Human

Sequence of Insert

GACTCGGCAGGTGATCATAG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU69594
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR nickase KO guide, use in conjunction with 69593.
• Low Temp: No