cDNA Clone FAM83G

• Synonyms: FLJ41564
• Plasmid: pU6 FAM83G Nter KO gRNA A
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: FAM83G Nter KO gRNA A
• Genbank: NM_001039999.2
• Species: Human

Sequence of Insert

GCAGGCCCACATCAAAGAGG(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48221
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses FAM83G KO gRNA A, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets sense strand in exon 2, to be used in conjunction with FAM83G KO gRNA B (DU48413), a ssDNA/dsDNA KO donor and Cas9 nickase. The donor introduces a novel EcoRI site to allow for RFLP screening of PCR products.