cDNA Clone CULLIN1

• Synonyms: CUL1
• Plasmid: pU6 CULLIN1 Nter gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: CULLIN1 Nter gRNA
• Genbank: NM_003592.2
• Species: Human

Sequence of Insert

GATTGGCCTGGACCAGATCT(GGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48275
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses CUL1 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets the first coding exon (2) close to the CUL1 start codon and is designed to knock-in a FLAG tag via CRISPR.