Synonyms
CUL3, CUL-3, FLJ25665, PHA2E
Plasmid
pSC-B CUllin3 L403-K459
Parent Plasmid
pSC-B
Genbank
NP_003581.1
Species
Human
Sequence of Insert
View Sequence
GGATCCCTAACAGAACAAGAAGTAGAAACAATATTGGATAAAGCAATGGTCCTTTTTAGGTTTATGCAAGAAAAAGATGTATTTGAACGTTATTATAAACAACACTTGGCAAGGAGACTTCTCACAAATAAAAGTGTTTCTGATGACTCTGAAAAAAACATGATATCTAAGTTAAAGTAAGCGGCCGC
Vector Type
Other
Antibiotic
Amp
DU Number
DU25730
Unit Source
Location
PPU
MTA
Price
£125.00
To submit an order for this reagent acceptance of the Dundee Material Transfer Agreement is required at checkout.

