cDNA Clone USP30

• Plasmid: pU6D USP30 Cter antisense guide
• Parent Plasmid: pU6D gRNA
• Expressed: USP30 Cter antisense guide
• Genbank: NM_032663.3
• Species: Human

Sequence of Insert

GGTGGACTTCTTGTCCTCGG(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48521
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses USP30 Cter KI antisense guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets (extra G added to improve expression from U6 promoter). Targets just upstream of the stop codon, PAM site situated on antisense strand. Designed to KI an in-frame GFP via CRISPR (wild-type or Nickase Cas9) when used in conjunction with the sense guide DU48612 and the GFP donor DU48549. To be screened for by GFP analysis and verified by PCR and western.