cDNA Clone MYSM1

• Synonyms: 2A-DUB, 2ADUB
• Plasmid: pU6D MYSM1 MslI KO guide B
• Parent Plasmid: pU6D gRNA
• Expressed: MYSM1 MslI KO guide B
• Genbank: ENSG00000162601
• Species: Human

Sequence of Insert

GCACGTCCCCTTAAACATGA(TGG)

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48652
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first coding exon (exon 8) of MYSM1, indel formation may lead to the deletion of an MslI site allowing RFLP screening. Guide sequence shown as sequence of insert with PAM in brackets.