cDNA Clone GRB2 mouse

• Synonyms: AA408164, Ash
• Plasmid: pKN7 GRB2m KO sense B
• Parent Plasmid: pKN7
• Expressed: GRB2m KO sense B guide
• Genbank: NM_008163.3
• Species: Mouse

Sequence of Insert

GCATCCGTAAGTCAGATTTTA

• Vector Type: Other
• Antibiotic: Kan
• DU Number: DU48856
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 3, to be co-transfected with antisense guide 48843 to KO GRB2. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.