cDNA Clone RAB8B

• Plasmid: pBABED P U6 RAB8B Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: RAB8B Nter KI sense guide
• Genbank: NM_016530.2
• Species: Human

Sequence of Insert

GCTCCTGCTGATCGGCGACT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48935
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand of exon 1, designed to KI an HA to tag to the N-terminus of RAB8B when co-transfected with antisense guide 48949 and donor 48994. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.