cDNA Clone VPS34

• Synonyms: PIK3C3, Vps34, hVps34
• Plasmid: pBABED P U6 VPS34 KI sense
• Parent Plasmid: pBABED P U6
• Expressed: VPS34 KI sense guide
• Genbank: NM_002647.3
• Species: Human

Sequence of Insert

GCTACATCTATAGTTGTGACC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52071
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide, use in conjunction with 52082 and donor.