cDNA Clone VPS15

• Plasmid: pX335 VPS15 KI antisense
• Parent Plasmid: pX335
• Expressed: VPS15 KI antisense guide + Cas9 D10A
• Genbank: NM_014602.2
• Species: Human

Sequence of Insert

GAGTTACGATGAAGCCCTGTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52081
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide, use in conjunction with 52070 and donor.