cDNA Clone SPAK (mouse)

• Synonyms: AW227544, AW556857, DCHT, RF005, Rnl5, Stk39
• Plasmid: pBABED P U6 SPAKm KO sense
• Parent Plasmid: pBABED P U6
• Expressed: SPAKm KO sense guide
• Genbank: ENSMUSG00000027030
• Species: Mouse

Sequence of Insert

AGGTTATCGGTCAGTGCGGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52188
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52196.