cDNA Clone RPA2

• Synonyms: REPA2, RP-A p32, RP-A p34, RPA32
• Plasmid: pBABED P U6 RPA2 Cter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: RPA2 Cter KI sense guide
• Genbank: ENSG00000117748
• Species: Human

Sequence of Insert

GCAGAATAACTGGATCTAAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52235
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Cter KI guide, use in conjunction with both 52247 and a suitable donor.