cDNA Clone SMAD1

• Synonyms: JV18, JV18-1, MADH2, MADR2, hMAD-2, hSMAD2
• Plasmid: pBABED P U6 SMAD1 Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: SMAD1 Nter KI sense guide
• Genbank: ENSG00000170365
• Species: Human

Sequence of Insert

GAGACTTCTTGGGTGGAAACA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52280
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR N-terminal KI guide, use in conjunction with 52299 and a suitable donor e.g. 52332.