cDNA Clone SNX9

• Synonyms: SDP1, SH3PX1, SH3PXD3A, WISP
• Plasmid: pBABED P U6 SNX9 Nter ex2 KI sense
• Parent Plasmid: pBABED P U6
• Expressed: SNX9 Nter ex2 KI sense guide
• Genbank: ENSG00000130340
• Species: Human

Sequence of Insert

GACCTGGAAATAATGAACTGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52337
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide targeting exon 2, use in conjunction with 52343 and a suitable donor.