cDNA Clone SPG15

• Synonyms: ZFYVE26, FYVE-CENT
• Plasmid: pBABED P U6 SPG15 Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: SPG15 Nter KI sense guide
• Genbank: ENSG00000072121
• Species: Human

Sequence of Insert

GTTTTCTGCGAATGCCTGCGG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52338
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52344 and a suitable donor.