cDNA Clone SLX4 mouse

• Synonyms: AI256635, AI426760, Btbd12, D16Bwg1016e
• Plasmid: pBABED P U6 SLX4m ex3 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: SLX4m ex3 KO sense guide
• Genbank: ENSMUSG00000039738
• Species: Human

Sequence of Insert

GACAGCAGGAGTTTAGAAGGG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52477
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 52481.