cDNA Clone RAB8A

• Synonyms: MEL, RAB8
• Plasmid: pX335 RAB8A Nter KI antisense
• Parent Plasmid: pX335
• Expressed: RAB8A Nter KI antisense guide + cas9 D10A
• Genbank: ENSG00000167461
• Species: Human

Sequence of Insert

GATATTACACTCTCTCCCCGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52679
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52654 and a suitable donor.