cDNA Clone SP1 (mouse)

• Plasmid: pBABED P U6 mSP1 ex2 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: mSP1 ex2 KO sense guide
• Genbank: ENSMUSG00000001280
• Species: Mouse

Sequence of Insert

GCACAGCTGTCACTTCATCCA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54175
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 2, use in conjunction with 54177.