cDNA Clone SRE

• Plasmid: pcDNA5D frtTO SRE (CAGAx12) LUC
• Parent Plasmid: pcDNA5D FRT/TO
• Expressed: LUC
• Species: Human

Sequence of Insert

CTCGAGAGCCAGACAAAAAGCCAGACATTTAGCCAGACA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48036
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: SRE (CAGAx12)-reporter excised from a pGL3-SRE-LUC vector and cloned into pcDNA5D FRT/TO replacing the promoter and MCS. Repeating unit shown as sequence of insert. Sequencing ongoing to determine the complete sequence of the insert and vector.