cDNA Clone TRIM49

• Synonyms: RNF18A, TRIM49L2
• Plasmid: pU6 TRIM49 Nter gRNA 2
• Parent Plasmid: pU6 gRNA
• Expressed: TRIM49 Nter gRNA 2
• Genbank: ENSG00000168930
• Species: Human

Sequence of Insert

GCTCCAGCTCTCAGGAGCAC(CGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48402
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses TRIM49 N-terminal guide RNA 2, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets the end of the first coding exon 3, PAM site situated on sense strand. Designed to KO TRIM49 by introducing an Indel via CRISPR. To be screened for by PCR and AgeI digestion, loss of the site shall indicate a deletion event and potential frameshift.