cDNA Clone STAT3

• Synonyms: ADMIO, APRF, HIES
• Plasmid: pX335 STAT3 ex4 KO antisense
• Parent Plasmid: pX335
• Expressed: STAT3 ex4 KO antisense guide + Cas9 D10A
• Genbank: ENSG00000168610
• Species: Human

Sequence of Insert

GTGATTCTTCCCACAGGCAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52467
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 2, use in conjunction with 52455.