cDNA Clone TRIM49

• Synonyms: RNF18A, TRIM49L2
• Plasmid: pBABED P U6 TRIM49 ex3 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: TRIM49 ex3 KO sense
• Genbank: ENSG00000168930
• Species: Human

Sequence of Insert

GCTATGAAGTAGTTCATGCAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54298
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR ex3 KO guide, use in conjunction with 54305.