Plasmid
pSCB-FBXL4 1-36
Parent Plasmid
pSC-B
Sequence of Insert
View Sequence
ATGTCACCGGTCTTTCCCATGTTAACAGTTCTGACCATGTTTTATTATATATGCCTTCGGCGCCGAGCCAGGACAGCTACAAGAGGAGAAATGATGAACACCCATAGA
Vector Type
Other
Antibiotic
Amp; Kan
DU Number
DU42977
Unit Source
Location
PPU
MTA
Price
£125.00
To submit an order for this reagent acceptance of the Dundee Material Transfer Agreement is required at checkout.

