Recombinant Protein - Parkin

Name: Parkin
Price per aliquot (100µg): £110.00
Catalog Number (DU Number):
26424
Expression:
mammalian cells
Native Sequence:
GGATCCATGATAGTGTTTGTCAGGTTCAACTCCAGCCATGGTTTCCCAGTGGAGGTCGATTCTGACACCAGCATCTTCCAGCTCAAGGAGGTGGTTGCTAAGCGACAGGGGGTTCCGGCTGACCAGTTGCGTGTGATTTTCGCAGGGAAGGAGCTGAGGAATGACTGGACTGTGCAGAATTGTGACCTGGATCAGCAGAGCATTGTTCACATTGTGCAGAGACCGTGGAGAAAAGGTCAAGAAATGAATGCAACTGGAGGCGACGACCCCAGAAACGCGGCGGGAGGCTGTGAGCGGGAGCCCCAGAGCTTGACTCGGGTGGACCTCAGCAGCTCAGTCCTCCCAGGAGACTCTGTGGGGCTGGCTGTCATTCTGCACACTGACAGCAGGAAGGACTCACCACCAGCTGGAAGTCCAGCAGGTAGATCAATCTACAACAGCTTTTATGTGTATTGCAAAGGCCCCTGTCAAAGAGTGCAGCCGGGAAAACTCAGGGTACAGTGCAGCACCTGCAGGCAGGCAACGCTCACCTTGACCCAGGGTCCATCTTGCTGGGATGATGTTTTAATTCCAAACCGGATGAGTGGTGAATGCCAATCCCCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAAGGGGGCAATGGCCTGGGCTGTGGGTTTGCCTTCTGCCGGGAATGTAAAGAAGCGTACCATGAAGGGGAGTGCAGTGCCGTATTTGAAGCCTCAGGAACAACTACTCAGGCCTACAGAGTCGATGAAAGAGCCGCCGAGCAGGCTCGTTGGGAAGCAGCCTCCAAAGAAACCATCAAGAAAACCACCAAGCCCTGTCCCCGCTGCCATGTACCAGTGGAAAAAAATGGAGGCTTCATGCACATGAAGTGTCCGCAGCCCCAATGCAGGCTCGAGTGGTGCTGGAACTGTGGCTGCGAGTGGAACCGCGTCTGCATGGGGGACCACTGGTTCGACGTGTAGGCGGCCGC

Do you need any help? Please get in touch and we’ll be happy to lend a hand.