cDNA Clone ULK1

• Synonyms: ATG1, ATG1A, UNC51, Unc51.1, hATG1
• Plasmid: pBabeD P U6 ULK1 Nter KI Sense
• Parent Plasmid: pBABED P U6
• Expressed: ULK1 N-Term Nter KI Sense Guide
• Genbank: ENSG00000177169
• Species: Human

Sequence of Insert

GTTCTCCCGCAAGGACCTGAT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU57396
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 57403 and a suitable donor.
• Low Temp: No