cDNA Clone PPM1H

• Synonyms: ARHCL1, NERPP-2C, URCC2
• Plasmid: pX335 PPM1H Cter KI Antisense A
• Parent Plasmid: pX335
• Expressed: PPM1H Cter KI Antisense A Guide + Cas9n
• Genbank: ENSG00000111110
• Species: Human

Sequence of Insert

GAGCTTGTTTCCATGTATTAA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU64674
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Cter KI guide, use in conjunction with 64668 and a suitable donor.
• Low Temp: No