cDNA Clone Ufl1/DDRGK1

• Synonyms: cHMM106
• Plasmid: pETDuet1 6His TEV Ufl1/StrepII DDRGK1 207-C
• Parent Plasmid: pETDuet1
• Expressed: 6His TEV Ufl1/StrepII DDRGK1 207-C
• Genbank: NM_023935.2
• Tag: StrepII
• Species: Human

Sequence of Insert

See snapgene map

Amino Acid Sequence

See snapgene map

• Vector Type: Bacterial
• Antibiotic: Amp
• Full Snapgene Map: pETDuet1 6His TEV Ufl1/StrepII DDRGK1 207-C760.88 KB Snapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU73842
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Mutagenesis of DU63479 using oligos CCGCAGTTCGAAAAAATGACTGAGGAACAGTCCCAGAG and CTGTTCCTCAGTCATTTTTTCGAACTGCGGGTGGCTCC to remove Ufbp1 29-206 and the 3C cleavage site. Made and deposited by Helge Magnussen (MRCPPU Kulathu group).
• Low Temp: No