cDNA Clone ZNRF2

• Plasmid: pSUPERIOR.neo-ZNRF2 shRNA 4
• Parent Plasmid: pSuperior neo
• Species: Human

Sequence of Insert

GATCGCTGCATAGATGAATGGTT----
###################
====CGACGTATCTACTTACCAATCGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU31399
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: All ZNRF2 plasmids MUST be grown at 30 degrees C or less to prevent recombination.