cDNA Clone Fan1

• Plasmid: pSC-B-Fan1 UBZ domain (inc start and stop)
• Parent Plasmid: pSC-B
• Genbank: NM_014967.3 GI:62198230
• Species: Human

Sequence of Insert

GGATCCATGGCCGGCAAACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCC
TAGATATGACTTAAACCGGCACCTTGATGAAATGTGTGCTAACAATGACT
TCTGAGGCGCCGCGGCCGC

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU20690
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Intermediate for construction of UBZ domain concatamers; ; All MTMR15 (FAN1) plasmids MUST be grown at 30 degrees C or less to prevent recombination.