cDNA Clone TRIM49

• Synonyms: RNF18, TRIM49L2
• Plasmid: pU6 TRIM49 Nter gRNA
• Parent Plasmid: pU6 gRNA
• Expressed: TRIM49 Nter gRNA
• Genbank: ENSG00000168930
• Species: Human

Sequence of Insert

GAATCTTACAGGTCTTTCAG(GGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48096
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses TRIM49 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets first coding exon (exon 3).