cDNA Clone TAB2

• Synonyms: CHTD2, MAP3K7IP2
• Plasmid: pU6 TAB2 Nter gRNA
• Parent Plasmid: pU6 gRNA
• Expressed: TAB2 Nter gRNA
• Genbank: ENSG00000055208
• Species: Human

Sequence of Insert

GTAAAACCTGAAAATCAATT(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48130
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses TAB2 N-terminal guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets close to the ATG start of the coding region in exon 3. PAM site situated on reverse strand.