cDNA Clone KIAA2022

• Synonyms: MRX98, XPN
• Plasmid: pU6 KIAA2022 Cter gRNA
• Parent Plasmid: pU6 gRNA empty IRES puro
• Expressed: KIAA2022 Cter gRNA
• Genbank: ENSG00000050030
• Species: Human

Sequence of Insert

GCGAGTCTCTTCTTCAAACAC(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48209
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses KIAA2022 guide RNA, 21mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets last coding exon (exon 4) on reverse strand.