cDNA Clone C15orf41

• Synonyms: HH114
• Plasmid: pU6 C15orf41 Nter gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: C15orf41 Nter gRNA
• Genbank: NM_001130010.2
• Species: Human

Sequence of Insert

GCGGCACAGACACTAGGCAC(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48269
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses C15orf41 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets lower strand of the first coding exon (exon 1) of the longest isoform (variant 1).