cDNA Clone HARBI1

• Synonyms: C11orf77
• Plasmid: pU6 HARBI1 Nter gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: HARBI1 Nter gRNA
• Genbank: NM_173811.3
• Species: Human

Sequence of Insert

GAAGGATGAATTCTATGGGT(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48281
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses HARBI1 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets first coding exon (exon 2) and is designed to KO HARBI1 by introducing an Indel via CRISPR. To be screened for by PCR and EcoRI digestion, loss of this site shall indicate a deletion event.