cDNA Clone TAB2

• Synonyms: CHTD2, MAP3K7IP2
• Plasmid: pU6 TAB2 Nter gRNA 2
• Parent Plasmid: pU6 gRNA
• Expressed: TAB2 Nter gRNA 2
• Genbank: ENSG00000055208
• Species: Human

Sequence of Insert

GAGAGTACAAGATATCTTTA(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48282
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses TAB2 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets exon 4 and is designed to KO TAB2 by introducing an Indel via CRISPR. To be screened for by PCR and EcoRV digestion, loss of the site shall indicate a deletion event.