cDNA Clone UBE3C

• Synonyms: HECTH2
• Plasmid: pU6 UBE3C Nter gRNA 2
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: UBE3C guide RNA 2
• Genbank: NM_014671.2
• Species: Human

Sequence of Insert

GATTGATGAGCCTCTGTTGC(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48283
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses UBE3C guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets exon 5 and is designed to KO UBE3C by introducing an Indel via CRISPR. To be screened for by PCR and ApoI digestion, loss of the site shall indicate a deletion event.