cDNA Clone SGK3

• Synonyms: CISK, SGKL
• Plasmid: pBABED P SGK3 Nter GFP donor + gRNA
• Parent Plasmid: 48215
• Expressed: SGK3 Nter gRNA
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GAGATCACACCATGGACTACA(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48291
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Retroviral vector expressing guide RNA complementary to the first coding exon of SGK3 (exon 2). 21mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. The construct contains a GFP donor sequence to KO the SGK3 allele following a successful CRISPR induced recombination event. The complete sequence of the donor including homology arms shown as sequence of cassette and contains several silent mutations to prevent Cas9 targeting the donor sequence. The donor cassette also contains a BGH polyadenylation signal downstream of GFP to prevent degradation of the transcript via NMD. Virus generated using this construct should be used to transduce a Tet-inducible cas9 expressing cell-line or co-infected with a virus encoding Tet-inducible Cas9.