cDNA Clone SGK3

• Synonyms: CISK, SGKL
• Plasmid: pBABED P SGK3 Cter GFP donor + gRNA
• Parent Plasmid: 48216
• Expressed: SGK3 Cter gRNA
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GAGGCAGATGATGCATTCGT(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48292
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Retroviral vector expressing guide RNA complementary to the last coding exon of SGK3 (exon 17). 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. The construct contains a GFP donor sequence to c-terminally tag the SGK3 allele following a successful CRISPR induced recombination event. The complete sequence of the donor including homology arms shown as sequence of cassette and contains several silent mutations to prevent Cas9 targeting the donor sequence. Virus generated using this construct should be used to transduce a Tet-inducible cas9 expressing cell-line or co-infected with a virus encoding Tet-inducible Cas9.