cDNA Clone CCDC99

• Synonyms: Spindly, hSpindly, protein Spindly, SPDL1
• Plasmid: pU6 SPDL1 Nter gRNA.2
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: SPDL1 Nter gRNA.2
• Genbank: NM_017785.4
• Species: Human

Sequence of Insert

GTAATCACAAATCTTCGATGC(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48301
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses SPDL1 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Note this contains an additional G at the N-terminus to aid expression from the U6 promoter, targets first coding exon (exon 2). Both of the guides should be co-transfected along with the donor to maximise the chances of targeting.