cDNA Clone CAND1

• Synonyms: KIAA0829, TIP120, TIP120A
• Plasmid: pU6 CAND1 gRNA A
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: CAND1 gRNA A
• Genbank: NP_060918.2
• Species: Human

Sequence of Insert

GTACCACATTTCCAATTTGC(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48388
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses CAND1 guide RNA A, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets coding region in exon 1, to be used in conjunction with CAND1 guide RNA B, a ssDNA KO donor and Cas9 nickase. PAM site is situated on the sense strand.