cDNA Clone ABIN1

• Synonyms: TNIP1, ABIN-1, NAF1, VAN, nip40-1
• Plasmid: pU6 ABIN1 Bsp1286I KO gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: ABIN1 Bsp1286I KO guide RNA
• Genbank: NM_001252385.1
• Species: Human

Sequence of Insert

GGGCAGCGTGCCCTCAGGAG(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48484
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses ABIN1 Bsp1286I KO guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Target site situated on sense strand in exon 2 and guide designed to KO ABIN1 by introducing an Indel via CRISPR. To be screened for by PCR and Bsp1286I digestion, loss of the site shall indicate a deletion event and potential frameshift.