cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pU6D SGK3 Nter guide
• Parent Plasmid: pU6D gRNA
• Expressed: SGK3 Nter gRNA
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GAGATCACACCATGGACTACA(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48554
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses SGK3 Nter KI sense guide RNA, 21mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets just downstream of the start codon, PAM site situated on sense strand. Designed to KI an in-frame GFP via CRISPR (wild-type Cas9) when used in conjunction with the antisense guide DU48559 and the GFP donor DU48167. To be screened for by GFP analysis and verified by PCR and western. May also be used in the absence of a donor and the KO screened for by RFLP-NcoI digestion.