cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pU6D SGK3 Cter KI guide B
• Parent Plasmid: pU6D gRNA
• Expressed: SGK3 Cter KI gRNA B
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GCATCATCTGCCTCCAATACAC(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48560
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses SGK3 Cter KI sense guide RNA, 22mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets just upstream of the stop codon, PAM site situated on antisense strand. Designed to KI an in-frame GFP via CRISPR (wild-type Cas9) when used in conjunction with the antisense guide DU48555 and the GFP donor DU48103. To be screened for by GFP analysis and verified by PCR and western.