cDNA Clone SGK1

• Synonyms: SGK
• Plasmid: pU6D SGK1 Nter KI guide B
• Parent Plasmid: pU6 gRNA
• Expressed: SGK1 Nter KI guide B
• Genbank: ENSG00000118515
• Species: Human

Sequence of Insert

GTTTGCATGCATAGGAGTTAT(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48593
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first common coding exon, indel formation may lead to the deletion of an NsiI site allowing RFLP screening. May be used to KI at the N-terminus. Guide sequence shown as sequence of insert with PAM in brackets.