cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pU6D SGK3 KO sense guide
• Parent Plasmid: pU6D gRNA
• Expressed: SGK3 KO sense guide
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GGATGAAAGAAGTTCTCAGA(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48656
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in first coding exon, may be used in conjunction with 48657 and Cas9 D10A where possible to improve specificity. Western blotting should be preferentially used to screen for KOs as there is a good antibody, alternatively indel formation may lead to the loss of a PsuI site allowing RFLP screening. Guide sequence shown as sequence of insert with PAM in brackets.